From: Charles Plessy <charles.plessy@oist.jp>
Date: Tue, 24 Jan 2023 00:25:55 +0000 (+0900)
Subject: Work In Progress from last year.
X-Git-Url: https://source.charles.plessy.org/?a=commitdiff_plain;h=dcf64a03bde69451e321f7e36ef40b1da1c9f54f;p=source--%2F.git

Work In Progress from last year.
---

diff --git a/biblio/20331767.mdwn b/biblio/20331767.mdwn
new file mode 100644
index 00000000..6782ce0a
--- /dev/null
+++ b/biblio/20331767.mdwn
@@ -0,0 +1,10 @@
+[[!meta title="Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water."]]
+[[!tag eDNA]]
+
+Stoeck T, Bass D, Nebel M, Christen R, Jones MD, Breiner HW, Richards TA
+
+Mol Ecol. 2010 Mar;19 Suppl 1:21-31. doi:10.1111/j.1365-294X.2009.04480.x
+
+Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water.
+
+[[!pmid 20331767 desc="The TAReuk454FWD1–TAReukREV3 pair (V4) detected more unique tags than the 1391F–EukB pair (V9)."]]
diff --git a/tags/eDNA.mdwn b/tags/eDNA.mdwn
index f15996b4..5b46ea4f 100644
--- a/tags/eDNA.mdwn
+++ b/tags/eDNA.mdwn
@@ -11,6 +11,8 @@
 
  - A Nextflow pipeline: eDNAFlow [[Mousavi‐Derazmahalleh and coll., 2021|biblio/10.1111_1755-0998.13356]].
 
+ - Universal or eukaryote-biased 18S primers targetting the V9 hypervariable region: [[Amaral-Zettler|biblio/19633714]]
+
 ### Published primers
 
 ```
@@ -22,11 +24,25 @@ GGAGCTGGAATTACCGC
 CCCTGCCHTTTGTACACAC
 >18S_1389F universal 10.1371/journal.pone.0006372
 TTGTACACACCGCCC
+>18S_1391F 10.1111/j.1365-294X.2009.04480.x (Lane 1991), S. cerevisiae NCBI GenBank nucleotide database accession # U53879 position 1629-1644)
+GTACACACCGCCCGTC
+>EukB 10.1111/j.1365-294X.2009.04480.x (Medlin et al. 1988), S. cerevisiae position 1774-1797). 
+TGATCCTTCTGCAGGTTCACCTAC
 >18S_1510R eukaryotic 10.1371/journal.pone.0006372
 CCTTCYGCAGGTTCACCTAC
 ```
 https://doi.org/10.1371/journal.pone.0073935
 
+
+V4
+```
+>TAReuk454FWD1 (S. cerevisiae position 565-584)
+CCAGCA(G/C)C(C/T)GCGGTAATTCC
+>TAReukREV3 (S. cerevisiae position 964-981)
+ACTTTCGTTCTTGATYRA
+```
+
+
 ```
 >UroCox1-244 F 10.2108/zsj.26.564
 CATTTWTTTTGATTWTTTRGWCATCCNGA