From: Charles Plessy Date: Thu, 15 Dec 2022 04:39:53 +0000 (+0900) Subject: 18S primers X-Git-Url: https://source.charles.plessy.org/?a=commitdiff_plain;h=d850dc33fc0236e9cbdcd77a2388f6f9d6a5a432;p=setup%2F.git 18S primers --- diff --git a/biblio/19633714.mdwn b/biblio/19633714.mdwn new file mode 100644 index 00000000..38e42bad --- /dev/null +++ b/biblio/19633714.mdwn @@ -0,0 +1,17 @@ +[[!meta title="A method for studying protistan diversity using massively parallel sequencing of V9 hypervariable regions of small-subunit ribosomal RNA genes."]] +[[!tag eDNA]] + +Amaral-Zettler LA, McCliment EA, Ducklow HW, Huse SM. + +PLoS One. 2009 Jul 27;4(7):e6372. doi:10.1371/journal.pone.0006372 + +A method for studying protistan diversity using massively parallel sequencing of V9 hypervariable regions of small-subunit ribosomal RNA genes. + +[[!pmid 19633714 desc="Primers contain degenerate sequences and are either universal or eukaryote-based. Samples from Mount Hope Bay, Massachusetts and Palmer Station, Antarctica."]] + + >18S_1380F eukaryotic 10.1371/journal.pone.0006372 + CCCTGCCHTTTGTACACAC + >18S_1389F universal 10.1371/journal.pone.0006372 + TTGTACACACCGCCC + >18S_1510R eukaryotic 10.1371/journal.pone.0006372 + CCTTCYGCAGGTTCACCTAC diff --git a/tags/eDNA.mdwn b/tags/eDNA.mdwn index 48987409..f15996b4 100644 --- a/tags/eDNA.mdwn +++ b/tags/eDNA.mdwn @@ -18,6 +18,12 @@ GCCAGTAGTCATATGCTTGTCT >18S_701R 10.1371/journal.pone.0073935 GGAGCTGGAATTACCGC +>18S_1380F eukaryotic 10.1371/journal.pone.0006372 +CCCTGCCHTTTGTACACAC +>18S_1389F universal 10.1371/journal.pone.0006372 +TTGTACACACCGCCC +>18S_1510R eukaryotic 10.1371/journal.pone.0006372 +CCTTCYGCAGGTTCACCTAC ``` https://doi.org/10.1371/journal.pone.0073935